Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T36310
Clone ID E36310
Template ID T36310
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Dvl1
Gene description dishevelled, dsh homolog 1 (Drosophila)
Gene Aliases Dvl, KIAA4029, mKIAA4029
MGI ID MGI:94941
Entrez Gene ID 13542
Ref Seq Accession NM_010091
Chromosome Location 4
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 096994_F_cDNA_Dvl1
Forward Primer Sequences CATACCACCAGGATATTGGCTT
Reverse Primer 096994_N_SP6_cDNA_Dvl1
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTGTCTAGTGTAGATGTGTGGGG
Template Plate 10022_TEM
Template Well 10022_TEM_C03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence