Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T36345
Clone ID E36345
Template ID T36345
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Epha3
Gene description Eph receptor A3
Gene Aliases AW492086, Cek4, ETK1, End3, Hek, Hek4, Mek4, Tyro4
MGI ID MGI:99612
Entrez Gene ID 13837
Ref Seq Accession NM_010140
Chromosome Location 16
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 089951_F_cDNA_Epha3
Forward Primer Sequences GAGTTACGGGATTGTTCTCTGG
Reverse Primer 089951_N_SP6_cDNA_Epha3
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCATTTCCATCTGTCTGCAGGAT
Template Plate 10022_TEM
Template Well 10022_TEM_H12
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence