Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T36450
Clone ID E36450
Template ID T36450
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Grid2ip
Gene description glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Gene Aliases  
MGI ID MGI:2176213
Entrez Gene ID 170935
Ref Seq Accession NM_133355
Chromosome Location 5
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 092364_F_cDNA_Grid2ip
Forward Primer Sequences AACAGGTGGAGAACTCAGAAGG
Reverse Primer 092364_N_SP6_cDNA_Grid2ip
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTCTTGTTGGTCTTGGGCTGT
Template Plate 10024_TEM
Template Well 10024_TEM_G06
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU  
 Template Sequence