Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T36700
Clone ID E36700
Template ID T36700
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Nrg1
Gene description neuregulin 1
Gene Aliases 6030402G23Rik, ARIA, D230005F13Rik, GGF, GGFII, HRG, HRGalpha, Hgl, NDF, SMDF, heregulin
MGI ID MGI:96083
Entrez Gene ID 211323
Ref Seq Accession XM_893383
Chromosome Location 8
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 081238_F_cDNA_Nrg1
Forward Primer Sequences CTTTCCACATCTACATCCACGA
Reverse Primer 081238_N_SP6_cDNA_Nrg1
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTGCTGTGCCTGCTGTTCTCTA
Template Plate 10029_TEM
Template Well 10029_TEM_C01
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence