Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T36707
Clone ID E36707
Template ID T36707
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Ntn1
Gene description netrin 1
Gene Aliases AI561871, BC019633, Netrin-1
MGI ID MGI:105088
Entrez Gene ID 18208
Ref Seq Accession NM_008744
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 098259_F_cDNA_Ntn1
Forward Primer Sequences CTTCCTCACCGACCTCAATAAC
Reverse Primer 098259_N_SP6_cDNA_Ntn1
Reverse Primer Sequences GCGATTTAGGTGACACTATAGTTGTGCCTACAGTCACACACC
Template Plate 10029_TEM
Template Well 10029_TEM_C09
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence