Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T3681
Clone ID E3681
Template ID T3681
Template Origin Plasmid
Clone Image 353011
Validity OK
Gene symbol Atf4
Gene description activating transcription factor 4 (Atf4)
Gene Aliases MGC, Atf-4, C/ATF, CREB2, TAXREB67
MGI ID MGI:88096
Entrez Gene ID 11911
Ref Seq Accession NM_009716
Chromosome Location 15
ENSEMBL Transcript ID ENSMUST00000044156
ENSEMBL Gene ID ENSMUSG00000042406
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 40
Template Well E01
Template Group  
Template Sequence Status Partial
Template Sequence ID 353011_r1AI430710W34
TGU B
 Template Sequence