Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T3684
Clone ID E3684
Template ID T3684
Template Origin Plasmid
Clone Image 353429
Validity OK
Gene symbol Mdk
Gene description midkine (Mdk), transcript variant 3
Gene Aliases MK, Mek, cytokine
MGI ID MGI:96949
Entrez Gene ID 17242
Ref Seq Accession NM_001012336
Chromosome Location 2
ENSEMBL Transcript ID ENSMUST00000069423
ENSEMBL Gene ID ENSMUSG00000027239
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 40
Template Well E04
Template Group  
Template Sequence Status Partial
Template Sequence ID 353429_r1BX515400W41
TGU B
 Template Sequence