Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T36975
Clone ID E36975
Template ID T36975
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Ror2
Gene description receptor tyrosine kinase-like orphan receptor 2
Gene Aliases Ntrkr2, mRor2
MGI ID MGI:1347521
Entrez Gene ID 26564
Ref Seq Accession NM_013846
Chromosome Location 13
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 096964_F_cDNA_Ror2
Forward Primer Sequences TCGACTCTGACATCTGGTCCTA
Reverse Primer 096964_N_SP6_cDNA_Ror2
Reverse Primer Sequences GCGATTTAGGTGACACTATAGACCTGGAGCGTGTCATTGTCT
Template Plate 10033_TEM
Template Well 10033_TEM_H10
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence