Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T37087
Clone ID E37087
Template ID T37087
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Stk10
Gene description serine/threonine kinase 10
Gene Aliases Gek1, KIAA4026, Lok, mKIAA4026
MGI ID MGI:1099439
Entrez Gene ID 20868
Ref Seq Accession NM_009288
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 098634_F_cDNA_Stk10
Forward Primer Sequences TACTAATGACATCACCGCGAAC
Reverse Primer 098634_N_SP6_cDNA_Stk10
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCTCTTGGGAGGCTACCTGAGC
Template Plate 10036_TEM
Template Well 10036_TEM_B07
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence