Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T3725
Clone ID E3725
Template ID T3725
Template Origin Plasmid
Clone Image 355676
Validity OK
Gene symbol Igf1r
Gene description insulin-like growth factor I receptor
Gene Aliases CD221, IGF-1R
MGI ID MGI:96433
Entrez Gene ID 16001
Ref Seq Accession NM_010513
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000005671
ENSEMBL Gene ID ENSMUSG00000005533
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 40
Template Well H09
Template Group  
Template Sequence Status Partial
Template Sequence ID 355676_r1AI893163BX5
TGU B
 Template Sequence