Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T3734
Clone ID E3734
Template ID T3734
Template Origin Plasmid
Clone Image 368357
Validity OK
Gene symbol Sf3a1
Gene description splicing factor 3a, subunit 1 (Sf3a1)
Gene Aliases 1200014H24Rik, 5930416L09Rik
MGI ID MGI:1914715
Entrez Gene ID 67465
Ref Seq Accession NM_026175
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000078991
ENSEMBL Gene ID ENSMUSG00000002129
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 41
Template Well A06
Template Group  
Template Sequence Status Partial
Template Sequence ID 368357_r1AI425561BX5
TGU B
 Template Sequence