Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T37592
Clone ID E37592
Template ID T37592
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Bhlhb4
Gene description basic helix-loop-helix domain containing, class B4
Gene Aliases A930001L02Rik, BETA4
MGI ID MGI:2153710
Entrez Gene ID 140489
Ref Seq Accession NM_080641
Chromosome Location 2
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 094574_F_cDNA_Bhlhb4
Forward Primer Sequences CAAGATAGCCACACTTCTGCTG
Reverse Primer 094574_N_SP6_cDNA_Bhlhb4
Reverse Primer Sequences GCGATTTAGGTGACACTATAGACGACCTCTCCAAAGGACCTC
Template Plate 10044_TEM
Template Well 10044_TEM_F04
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence