Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T37782
Clone ID E37782
Template ID T37782
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Lmod2
Gene description leiomodin 2 (cardiac)
Gene Aliases C-Lmod
MGI ID MGI:2135672
Entrez Gene ID 93677
Ref Seq Accession NM_053098
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 079268_F_cDNA_Lmod2
Forward Primer Sequences TTTGGCTACAGAAGGGGACTTA
Reverse Primer 079268_N_SP6_cDNA_Lmod2
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGCTGAACGTCTTCACCACTGT
Template Plate 10047_TEM
Template Well 10047_TEM_D09
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence