Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T3815
Clone ID E3815
Template ID T3815
Template Origin Plasmid
Clone Image 405832
Validity OK
Gene symbol P2ry2
Gene description purinergic receptor P2Y, G-protein coupled 2 (P2ry2)
Gene Aliases P2Y2
MGI ID MGI:105107
Entrez Gene ID 18442
Ref Seq Accession NM_008773
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000037540
ENSEMBL Gene ID ENSMUSG00000032860
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 41
Template Well H03
Template Group  
Template Sequence Status Partial
Template Sequence ID 405832_r1AI893972BX5
TGU B
 Template Sequence