Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T38445
Clone ID E38445
Template ID T38445
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Msx2
Gene description homeo box, msh-like 2
Gene Aliases BB122635, Hox-8, Hox8, Hox8.1
MGI ID MGI:97169
Entrez Gene ID 17702
Ref Seq Accession NM_013601
Chromosome Location 13
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 150806_F_cDNA_Msx2
Forward Primer Sequences AAAGTTGGAGTCTTCGCTTGAG
Reverse Primer 150806_N_SP6_cDNA_Msx2
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCCGCTCTGCTATGGACAGGTA
Template Plate 10064_TEM
Template Well 10064_TEM_G07
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU  
 Template Sequence