Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T38906
Clone ID E38906
Template ID T38906
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Hdac9
Gene description histone deacetylase 9
Gene Aliases AV022454, D030072B18Rik, HD7B, HD9, HDRP, Hdac7b, Mitr, mKIAA0744
MGI ID MGI:1931221
Entrez Gene ID 79221
Ref Seq Accession NM_024124
Chromosome Location 12
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 270552_F_cDNA_Hdac9
Forward Primer Sequences CCTTCACTGGTAAGAAAATGCC
Reverse Primer 270552_N_SP6_cDNA_Hdac9
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTATTTGCCAGAACGATCTGATG
Template Plate 10087_TEM
Template Well 10087_TEM_C10
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence