Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T39017
Clone ID E39017
Template ID T39017
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Tsga8
Gene description testis specific gene A8
Gene Aliases Halap-X, Halapx, haploid specific alanine rich acidic protein, X chromosome
MGI ID MGI:1194903
Entrez Gene ID 60600
Ref Seq Accession NM_021898
Chromosome Location X
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 265474_F_cDNA_Tsga8
Forward Primer Sequences GGTACATTCTGCTCCTTTCACC
Reverse Primer 265474_N_SP6_cDNA_Tsga8
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGGTGGAGTAGTTTCTCCGATGTC
Template Plate 10089_TEM
Template Well 10089_TEM_C05
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU  
 Template Sequence