Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T39317
Clone ID E39317
Template ID T39317
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Cdk10
Gene description cyclin-dependent kinase (CDC2-like) 10
Gene Aliases BC017131
MGI ID MGI:2448549
Entrez Gene ID 234854
Ref Seq Accession NM_194444
Chromosome Location 8
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 277269_F_cDNA_Cdk10
Forward Primer Sequences CCACCCAGACTACCAGCATT
Reverse Primer 277269_N_SP6_cDNA_Cdk10
Reverse Primer Sequences GCGATTTAGGTGACACTATAGCACACACACTGAATGGGACCT
Template Plate 10093_TEM
Template Well 10093_TEM_B03
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence