Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T39582
Clone ID E39582
Template ID T39582
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Hoxc11
Gene description homeo box C11
Gene Aliases Hox-3.7
MGI ID MGI:96193
Entrez Gene ID 109663
Ref Seq Accession NM_001024842
Chromosome Location 15
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 104727_F_cDNA_LOC239679
Forward Primer Sequences TACTACGTGCCTGAGTTCTCCA
Reverse Primer 104727_N_SP6_cDNA_LOC239679
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGCCGTAGGAGCCTTCATTTTT
Template Plate 10061_TEM
Template Well 10061_TEM_G08
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence