Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T3991
Clone ID E3991
Template ID T3991
Template Origin Plasmid
Clone Image 5144166
Validity OK
Gene symbol Pdlim4
Gene description PDZ and LIM domain 4
Gene Aliases Ril
MGI ID MGI:1353470
Entrez Gene ID 30794
Ref Seq Accession NM_019417
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID ENSMUSG00000020388
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 44
Template Well F07
Template Group ENCODE
Template Sequence Status Full-length
Template Sequence ID BC030068
TGU B
 Template Sequence