Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T4052
Clone ID E4052
Template ID T4052
Template Origin Plasmid
Clone Image 6413315
Validity OK
Gene symbol Ctsd
Gene description cathepsin D
Gene Aliases CD, CatD
MGI ID MGI:88562
Entrez Gene ID 13033
Ref Seq Accession NM_009983
Chromosome Location 7
ENSEMBL Transcript ID  
ENSEMBL Gene ID ENSMUSG00000007891
ENSEMBL version  
Vector (Plasmid) pYX-Asc
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD T3
Forward Primer Sequences ATTAACCCTCACTAAAGGGA
Reverse Primer RZPD T7
Reverse Primer Sequences TAATACGACTCACTATAGGG
Template Plate 45
Template Well C10
Template Group ENCODE
Template Sequence Status Full-length
Template Sequence ID BC054758
TGU B
 Template Sequence