Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T4360
Clone ID E4360
Template ID T4360
Template Origin Plasmid
Clone Image 4527997
Validity OK
Gene symbol Rom1
Gene description rod outer segment membrane protein 1 (Rom1)
Gene Aliases Rom-1, Tspan23
MGI ID MGI:97998
Entrez Gene ID 19881
Ref Seq Accession NM_009073
Chromosome Location 19
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 49
Template Well A01
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC014827
TGU M
 Template Sequence