Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T4420
Clone ID E4420
Template ID T4420
Template Origin Plasmid
Clone Image 4923403
Validity OK
Gene symbol Msx1
Gene description homeo box, msh-like 1 (Msx1)
Gene Aliases msh, Hox7, Hox-7, Hox7.1
MGI ID MGI:97168
Entrez Gene ID 17701
Ref Seq Accession NM_010835
Chromosome Location 5
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 49
Template Well F03
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC016426
TGU M
 Template Sequence