Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T45191
Clone ID E45191
Template ID T45191
Template Origin genomic DNA
Clone Image  
Validity OK
Gene symbol Mlxip
Gene description MLX interacting protein
Gene Aliases AW228700, B930074I24, Mir, mKIAA0867
MGI ID MGI:2141183
Entrez Gene ID 208104
Ref Seq Accession NM_177582
Chromosome Location 5
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 188674_F_exon_B930074I24
Forward Primer Sequences TCCCTGTCTTTACGATGACCTT
Reverse Primer 188674_N_SP6_exon_B930074I24
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGCTGCTTGTGTCTCACTCCAG
Template Plate 10102_TEM
Template Well 10102_TEM_C04
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence