Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T4796
Clone ID E4796
Template ID T4796
Template Origin Plasmid
Clone Image 5052843
Validity OK
Gene symbol Creb3l2
Gene description cAMP responsive element binding protein 3-like 2 (Creb3l2)
Gene Aliases BBF2H7, C530025K05Rik
MGI ID MGI:2442695
Entrez Gene ID 208647
Ref Seq Accession NM_178661
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 53
Template Well E11
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC043466
TGU M
 Template Sequence