Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T4893
Clone ID E4893
Template ID T4893
Template Origin Plasmid
Clone Image 5100313
Validity OK
Gene symbol Cdh2
Gene description cadherin 2 (Cdh2)
Gene Aliases CDHN, Ncad, N-cadherin
MGI ID MGI:88355
Entrez Gene ID 12558
Ref Seq Accession NM_007664
Chromosome Location 18
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 54
Template Well F06
Template Group ENCODE
Template Sequence Status Full-length
Template Sequence ID BC022107
TGU M
 Template Sequence