Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T51129
Clone ID E51129
Template ID T51129
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Tjp1
Gene description tight junction protein 1
Gene Aliases
MGI ID  
Entrez Gene ID 21872
Ref Seq Accession NM_009386
Chromosome Location 7
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter  
Sense Promoter  
Forward Primer  
Forward Primer Sequences ACCCAGCAAAGGTGTACAGG
Reverse Primer  
Reverse Primer Sequences AAGCTGGCAGTGTCATTCA
Template Plate  
Template Well  
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU H
 Template Sequence