Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T5462
Clone ID E5462
Template ID T5462
Template Origin Plasmid
Clone Image 5372625
Validity OK
Gene symbol Fkhl18
Gene description forkhead-like 18 (Drosophila) (Fkhl18)
Gene Aliases Fkh3, FREAC10
MGI ID MGI:95546
Entrez Gene ID 14239
Ref Seq Accession NM_010226
Chromosome Location 2
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 60
Template Well A06
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC096604
TGU M
 Template Sequence