Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T55027
Clone ID na
Template ID T55027
Template Origin cDNA
Clone Image na
Validity OK
Gene symbol Crebzf
Gene description CREB/ATF bZIP transcription factor
Gene Aliases 1110034C16Rik; AI606244; Crebzf; HCF-binding transcription factor Zhangfei; LAZip; LAZipII; tyrosine kinase-associated leucine zipper protein LAZipII; Zf
MGI ID  
Entrez Gene ID 233490
Ref Seq Accession NM_145151
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000107206
ENSEMBL Gene ID ENSMUSG00000051451
ENSEMBL version na
Vector (Plasmid) na
AntiSense Promoter na
Sense Promoter na
Forward Primer na
Forward Primer Sequences CCTCAGTGCTTTTCCTGCAT
Reverse Primer na
Reverse Primer Sequences CATGGCTCCCACAATTACTG
Template Plate na
Template Well na
Template Group  
Template Sequence Status na
Template Sequence ID na
TGU H
 Template Sequence