Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T55078
Clone ID na
Template ID T55078
Template Origin cDNA
Clone Image na
Validity OK
Gene symbol Hoxc6
Gene description homeo box C6
Gene Aliases homeobox C6; Hox-3.3; Hox-6.1; Hoxc6
MGI ID  
Entrez Gene ID 15425
Ref Seq Accession NM_010465
Chromosome Location 15
ENSEMBL Transcript ID ENSMUST00000001711
ENSEMBL Gene ID ENSMUSG00000001661
ENSEMBL version na
Vector (Plasmid) na
AntiSense Promoter na
Sense Promoter na
Forward Primer na
Forward Primer Sequences ACAGCCTGGGAGGAAAAGAG
Reverse Primer na
Reverse Primer Sequences ATTCGAGAACGGATCCAGAG
Template Plate na
Template Well na
Template Group  
Template Sequence Status na
Template Sequence ID na
TGU H
 Template Sequence