Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T5667
Clone ID E5667
Template ID T5667
Template Origin Plasmid
Clone Image 2582185
Validity OK
Gene symbol Tcea1
Gene description transcription elongation factor A (SII) 1 (Tcea1)
Gene Aliases MGC, S-II
MGI ID MGI:1196624
Entrez Gene ID 21399
Ref Seq Accession NM_011541
Chromosome Location 1
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 62
Template Well C04
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC061490
TGU M
 Template Sequence