Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T5806
Clone ID E5806
Template ID T5806
Template Origin Plasmid
Clone Image 2811749
Validity OK
Gene symbol Rgs19ip1
Gene description regulator of G-protein signaling 19 interacting protein 1 (Rgs19ip1)
Gene Aliases GIPC, TIP-2, TaxIP2, Semcap1, Glut1CIP
MGI ID MGI:1926252
Entrez Gene ID 67903
Ref Seq Accession NM_018771
Chromosome Location 8
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 63
Template Well G02
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC003490
TGU B
 Template Sequence