Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T583
Clone ID E583
Template ID T583
Template Origin Plasmid
Clone Image 1885381
Validity OK
Gene symbol Rgs16
Gene description regulator of G-protein signaling 16 (Rgs16)
Gene Aliases Rgsr, Rgs14
MGI ID MGI:108407
Entrez Gene ID 19734
Ref Seq Accession NM_011267
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000027748
ENSEMBL Gene ID ENSMUSG00000026475
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 7
Template Well C06
Template Group  
Template Sequence Status Partial
Template Sequence ID 1885381_r1AI157349BX
TGU B
 Template Sequence