Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T5883
Clone ID E5883
Template ID T5883
Template Origin Plasmid
Clone Image 3156840
Validity OK
Gene symbol 2610206B13Rik
Gene description RIKEN cDNA 2610206B13 gene (2610206B13Rik)
Gene Aliases MGC35679, 2810449K13Rik
MGI ID MGI:1919736
Entrez Gene ID 72486
Ref Seq Accession NM_026047
Chromosome Location 14
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate  
Template Well  
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC029231
TGU  
 Template Sequence