Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T5935
Clone ID E5935
Template ID T5935
Template Origin Plasmid
Clone Image 3483088
Validity OK
Gene symbol Cxcl12
Gene description chemokine (C-X-C motif) ligand 12 (Cxcl12), transcript variant 1
Gene Aliases PBSF, Sdf1, TLSF, SDF-1, Sdf1a, Sdf1b, T
MGI ID MGI:103556
Entrez Gene ID 20315
Ref Seq Accession NM_021704
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 65
Template Well D05
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC006640
TGU B
 Template Sequence