Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T60077
Clone ID E60077
Template ID T60077
Template Origin RT-PCR
Clone Image  
Validity OK
Gene symbol Slc16a2
Gene description solute carrier family 16 (monocarboxylic acid transporters), member 2
Gene Aliases Mct8, Xpct
MGI ID MGI:1203732
Entrez Gene ID 20502
Ref Seq Accession NM_009197
Chromosome Location X
ENSEMBL Transcript ID  
ENSEMBL Gene ID ENSMUSG00000033965
ENSEMBL version
Vector (Plasmid)  
AntiSense Promoter T7
Sense Promoter  
Forward Primer SLC16A2_1_f
Forward Primer Sequences cggctcacctcattagggactcagc
Reverse Primer SLC16A2_1_r
Reverse Primer Sequences TAATACGACTCACTATAGGGAGcggaaagcacacaagcccacacg
Template Plate
Template Well  
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU SANGER
 Template Sequence