Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T63022
Clone ID E63022
Template ID T63022
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Mre11a
Gene description meiotic recombination 11 homolog A (S. cerevisiae) (Mre11a)
Gene Aliases Mre11, Mre11b
MGI ID MGI:1100512
Entrez Gene ID 17535
Ref Seq Accession NM_018736
Chromosome Location 9
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer 072972_F_cDNA_Mre11a
Forward Primer Sequences GAAGAGATCAACTTTGGGATGC
Reverse Primer 072972_N_SP6_cDNA_Mre11a
Reverse Primer Sequences GCGATTTAGGTGACACTATAGGTTGTCGGGTAGATCTGAAAGC
Template Plate 10028_TEM
Template Well 10028_TEM_C12
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU M
 Template Sequence