Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T6343
Clone ID E6343
Template ID T6343
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Inha
Gene description inhibin alpha (Inha)
Gene Aliases AW555078
MGI ID MGI:96569
Entrez Gene ID 16322
Ref Seq Accession NM_010564
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000037330
ENSEMBL Gene ID ENSMUSG00000032968
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer  
Forward Primer Sequences AGGCCTCTTCACTTATGTATTC
Reverse Primer  
Reverse Primer Sequences gcgATTTAGGTGACACTATAG-TTTTTATTGTTATCCACAGGAC
Template Plate  
Template Well  
Template Group ENCODE
Template Sequence Status Partial
Template Sequence ID  
TGU M
 Template Sequence