Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T6370
Clone ID E6370
Template ID T6370
Template Origin cDNA
Clone Image  
Validity OK
Gene symbol Hoxa3
Gene description  
Gene Aliases  
MGI ID MGI:96175
Entrez Gene ID 15400
Ref Seq Accession NM_010452
Chromosome Location 6
ENSEMBL Transcript ID ENSMUST00000071583
ENSEMBL Gene ID ENSMUSG00000059723
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter Sp6
Sense Promoter  
Forward Primer  
Forward Primer Sequences GTAGAGCTGGAGAAGGAGTTC
Reverse Primer  
Reverse Primer Sequences gcgATTTAGGTGACACTATAG-TGTTGCTACTGATACTGACAGC
Template Plate  
Template Well  
Template Group ENCODE
Template Sequence Status Partial
Template Sequence ID  
TGU M
 Template Sequence