Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T6650
Clone ID E6650
Template ID T6650
Template Origin Plasmid
Clone Image 3599914
Validity OK
Gene symbol Scap2
Gene description src family associated phosphoprotein 2 (Scap2).
Gene Aliases RA70, Saps, SKAP-HOM, mSKAP55R, 2610021A
MGI ID MGI:1889206
Entrez Gene ID 54353
Ref Seq Accession NM_018773
Chromosome Location 6
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 71
Template Well G01
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC003711
TGU B
 Template Sequence