Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T6780
Clone ID E6780
Template ID T6780
Template Origin Plasmid
Clone Image 3707718
Validity OK
Gene symbol Pax9
Gene description paired box gene 9 (Pax9).
Gene Aliases Pax-9
MGI ID MGI:97493
Entrez Gene ID 18511
Ref Seq Accession NM_011041
Chromosome Location 12
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 73
Template Well A11
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC005794
TGU M
 Template Sequence