Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T6836
Clone ID E6836
Template ID T6836
Template Origin Plasmid
Clone Image 3963113
Validity OK
Gene symbol Prdx3
Gene description peroxiredoxin 3 (Prdx3).
Gene Aliases Aop1, Ef2l, Mer5, Prx3, SP22, TDXM, D0To
MGI ID MGI:88034
Entrez Gene ID 11757
Ref Seq Accession NM_007452
Chromosome Location 19
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 73
Template Well F07
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC005626
TGU M
 Template Sequence