Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T6842
Clone ID E6842
Template ID T6842
Template Origin Plasmid
Clone Image 3964134
Validity OK
Gene symbol Rab9
Gene description RAB9, member RAS oncogene family (Rab9).
Gene Aliases Sid6061p, 2410064E05Rik
MGI ID MGI:1890695
Entrez Gene ID 56382
Ref Seq Accession NM_019773
Chromosome Location X
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 73
Template Well G01
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC008160
TGU M
 Template Sequence