Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T6939
Clone ID E6939
Template ID T6939
Template Origin Plasmid
Clone Image 3983850
Validity OK
Gene symbol Tcfap2a
Gene description transcription factor AP-2, alpha (Tcfap2a).
Gene Aliases Ap2, Ap2tf
MGI ID MGI:104671
Entrez Gene ID 21418
Ref Seq Accession NM_011547
Chromosome Location 13
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 74
Template Well G12
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC018226
TGU M
 Template Sequence