Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T7074
Clone ID E7074
Template ID T7074
Template Origin Plasmid
Clone Image 4012961
Validity OK
Gene symbol Ftsj3
Gene description FtsJ homolog 3 (E. coli)
Gene Aliases AA537063, AU045295, C79843, D11Ertd400e, Epcs3
MGI ID MGI:1860295
Entrez Gene ID 56095
Ref Seq Accession NM_025310
Chromosome Location 11
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 76
Template Well C08
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC012281
TGU B
 Template Sequence