Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T71073
Clone ID na
Template ID T71073
Template Origin cDNA
Clone Image na
Validity OK
Gene symbol Wnt5b
Gene description wingless-related MMTV integration site 5B
Gene Aliases wingless-related MMTV integration site 5B; Wnt-5b
MGI ID  
Entrez Gene ID 22419
Ref Seq Accession NM_009525
Chromosome Location 6
ENSEMBL Transcript ID ENSMUST00000119369
ENSEMBL Gene ID ENSMUSG00000030170
ENSEMBL version  
Vector (Plasmid)  
AntiSense Promoter  
Sense Promoter  
Forward Primer  
Forward Primer Sequences TTCCACTGGTGTTGCTTT
Reverse Primer  
Reverse Primer Sequences ACACTCATCTTCCCCACAGG
Template Plate  
Template Well  
Template Group  
Template Sequence Status  
Template Sequence ID  
TGU H
 Template Sequence