Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T7256
Clone ID E7256
Template ID T7256
Template Origin Plasmid
Clone Image 4164289
Validity OK
Gene symbol Egf
Gene description epidermal growth factor
Gene Aliases AI790464
MGI ID MGI:95290
Entrez Gene ID 13645
Ref Seq Accession NM_010113
Chromosome Location 3
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 78
Template Well C01
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC060741
TGU B
 Template Sequence