Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T7300
Clone ID E7300
Template ID T7300
Template Origin Plasmid
Clone Image 4168250
Validity OK
Gene symbol Eng
Gene description endoglin
Gene Aliases AI528660, CD105, S-endoglin
MGI ID MGI:95392
Entrez Gene ID 13805
Ref Seq Accession NM_007932
Chromosome Location 2
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 78
Template Well F09
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC029080
TGU B
 Template Sequence