Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T7506
Clone ID E7506
Template ID T7506
Template Origin Plasmid
Clone Image 4238842
Validity OK
Gene symbol Hnf4a
Gene description hepatic nuclear factor 4, alpha
Gene Aliases D19Mgi10, HNF-4, Hnf4, MODY1, Nr2a1, Tcf14, Tcf4
MGI ID MGI:109128
Entrez Gene ID 15378
Ref Seq Accession NM_008261
Chromosome Location 2
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 81
Template Well F08
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC039220
TGU M
 Template Sequence