Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
     Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Template ID: T7561
Clone ID E7561
Template ID T7561
Template Origin Plasmid
Clone Image 4241283
Validity OK
Gene symbol F730014I05Rik
Gene description RIKEN cDNA F730014I05 gene
Gene Aliases 2310022K11Rik, 4930445K14Rik, C20orf67, MGC25976, PCIF1
MGI ID MGI:2443858
Entrez Gene ID 228866
Ref Seq Accession NM_146129
Chromosome Location 2
ENSEMBL Transcript ID  
ENSEMBL Gene ID  
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 82
Template Well C03
Template Group  
Template Sequence Status Full-length
Template Sequence ID BC031431
TGU M
 Template Sequence